Wochenrückblick: Rente ab 66 und Europa belügt sich bei E-Autos selbst

Rumänien verbietet Insekten-Produkte zu verwenden. Deutschland ist das einzige EU-Land mit mehr Mietern als Eigentümern. Und Tesla hat die ersten Cybertrucks ausgeliefert – ab schlappen 56.000 Euro. Und eine 1 KByte DNA-Speicher-Card für 1.000 Euro. Ein unvollständiger Rückblick auf Ereignisse dieser Woche als Kurznachrichten.
Titelbild
Winterschwimmen in einem See in Nowosibirsk (Russland) bei minus 35 Grad Celsius. 9. December 2023.Foto: VLADIMIR NIKOLAYEV/AFP via Getty Images
Von 9. Dezember 2023

Rente ab 66 Jahren

Ab 1. Januar steigt die reguläre Altersgrenze für die Rente auf 66 Jahre. Das gilt für diejenigen, die 1958 geboren wurden. Für diejenigen, die später geboren wurden, erhöht sich das Eintrittsalter in Zwei-Monats-Schritten weiter. 2031 ist dann die reguläre Altersgrenze von 67 Jahren erreicht. Auch die Altersgrenze für „Rente ab 63“ steigt – für 1960 Geborene auf 64 Jahre und vier Monate. Diese kann von denen in Anspruch genommen werden, die mindestens 45 Jahre in der gesetzlichen Rentenversicherung versichert waren. Wer 35 Versicherungsjahre hat, muss Abschläge hinnehmen: 0,3 Prozent je Monat. Wer neu in den Ruhestand geht, muss einen höheren Teil seiner Rente versteuern (84 statt 83 Prozent). Der Beitragssatz zur gesetzlichen Rentenversicherung beträgt für Beschäftigte weiterhin 18,6 Prozent.

Grenzen für Mini- und Midi-Jobs

Die monatliche Verdienstgrenze für Minijobber steigt 2024 von 520 Euro auf 538 Euro. Diese orientiert sich am Mindestlohn. Da sich der Mindestlohn von zwölf Euro auf 12,41 Euro erhöht, steigt auch die Minijob-Grenze. Damit können Minijobber zwei Stunden pro Arbeitstag (10 h/Woche; 43,3 h/Monat) mit Mindestlohn arbeiten. Beschäftigte mit einem Verdienst zwischen 538,01 und 2.000 Euro zählen als Midijobber. Sie zahlen einen reduzierten Beitragsanteil zur Sozialversicherung, der bis zum Erreichen der Obergrenze von 2.000 Euro steigt.

Wenn ein Scheich den „Daily Telegraph“ kauft

Der „Daily Telegraph“, eine der einflussreichsten konservativen Medien Großbritanniens, steht mit ungefähr 1,458 Milliarden Euro in den Miesen – und zum Verkauf. Ende November endete der Bieterprozess; das amerikanische Konsortium Redbird IMI kam zum Zuge. Sofort gingen die Alarmglocken an: Dahinter verbirgt sich Scheich Mansur bin Zayed Al Nahyan, Vizepräsident und führendes Mitglied der Herrscherfamilie der Vereinigten Arabischen Emirate. Bis Ende Januar prüfen nun die Wettbewerbsbehörde CMA und die Ofcom die Transaktion. Der Scheich besitzt bereits den Fußballclub Manchester; Queen Elisabeth II. hatte sehr enge persönliche Beziehungen zu den Golfmonarchien. Ob die Übernahme eines Leitmediums durch einen anderen Staat möglich ist, ist umstritten.

Moody’s warnt China

Die Ratingagentur Moody’s droht Peking mit einer Abstufung der Bonitätsnote: von stabil auf negativ. Aktuell wird China mit A1 gelistet (die fünfthöchste Kreditnote bei Moody’s). Ein negativer Ausblick gilt als Vorstufe für eine mögliche Herabstufung der Bonität. Der Grund: erhebliche finanzielle Unterstützung von Peking an die Lokalregierungen und viele staatseigene Unternehmen. Das seien Risiken für die Staatsfinanzen, die ökonomische Entwicklung und die Stärke der Institutionen. Zudem verweist Moody’s auf die Gefahr eines dauerhaft niedrigen Wirtschaftswachstums, Risiken im Immobiliensektor und Rekordarbeitslosigkeit bei Jugendlichen.

85 Leute müssen gehen

Der Photovoltaikhersteller Solarwatt in Dresden entlässt etwa zehn Prozent seiner Belegschaft. Die Organisationsstruktur soll zum Jahresende verschlankt werden. Das 1993 gegründete Unternehmen kritisiert ungewöhnlich deutlich die Bundesregierung. Diese habe noch keine raschen und einfachen Lösungen gefunden, um den ungleichen Wettbewerb mit chinesischen und US-amerikanischen Herstellern auszugleichen. Beide Staaten subventionieren stark die Solarbranche, was zu Wettbewerbsverzerrungen führt. Währenddessen brachte Solarwatt zwischen 2020 und 2023 erhebliche Summen für die Forschung, Entwicklung und Produktion selbst auf. Solarwatt produziert unter anderem Stromspeicher, Aufdachsolaranlagen und innovative Balkonkraftwerke.

Europa belügt sich bei E-Autos selbst

„Europa lügt sich beim E-Auto in die eigene Tasche“, sagt Carlos Tavares, Chef des Autokonzerns Stellantis. Die Kosten seien um 40 Prozent zu hoch und das Verbot von Benzin- und Dieselautos in der EU ein Fehler, den kaum jemand unterstütze. Der europäische Plan für einen Übergang zum Elektroauto sei in seiner aktuellen Form unrealistisch. Tavares warnt: „Wer die Menschen in immer mehr Bereichen davon abhält, ihre Autos zu nutzen, weil sie keinen Verbrenner mehr fahren dürfen und sich ein E-Auto nicht leisten können, beraubt sie ihres Rechts auf freie, individuelle Mobilität. Damit riskiert man Revolten unter anderem in Frankreich, Portugal und Deutschland.“ Nutznießer ist China, das mit billigen Elektroautos auf den europäischen Markt drängt.

Aller guten Dinge sind 60

59 Mal probiert, 59 Mal ist nichts passiert: Erst im 60. Versuch hat ein Prüfling in England die theoretische Fahrprüfung gemeistert. Die Prüfung besteht ähnlich wie in Deutschland aus 50 Fragen mit jeweils mehreren Antwortmöglichkeiten. Mindestens 43 korrekte Antworten sind nötig, um zu bestehen. Dann folgt ein Videotest, bei dem in 14 Verkehrssituationen die mögliche Gefahr erkannt werden muss. Insgesamt musste der Fahrschüler in der Stadt Redditch bei Birmingham 1.380 Pfund (1.608 Euro) an Gebühren bezahlen – eine theoretische Prüfung kostet 23 Pfund. Die 59 vergeblichen Versuche des Fahranfängers sind Rekord im ersten Halbjahr 2023. Rekordhalter ist einer von 2012: Damals scheiterte ein Prüfling 92 Mal.

Erste Cybertrucks ausgeliefert

Tesla lieferte in seiner Firmenzentrale in Austin, Texas, erste Cybertrucks an Kunden aus. Die Einstiegsvariante (2025 verfügbar) kostet umgerechnet rund 56.000 Euro und erlaubt einen Sprint von 0 auf 100 km/h in unter sieben Sekunden. Leistungsdaten der Single-Motor-Version wurden nicht genannt. Die Reichweite wurde mit 400 Kilometern angegeben. Die Allradversion punktet mit einem Dual-Motor mit 450 kW/610 PS: von 0 auf 100 in rund vier Sekunden. Schlappe Kosten: 73.500 Euro. Und die Topversion, das Cyberbeast, kommt mit einem dreimotorigen Allradantrieb 630 kW/857 PS daher. Dieser Truck (3 Tonnen Gewicht) beschleunigt von 0 auf 100 in weniger als drei Sekunden, kommt auf 210 Stundenkilometer, 510 Kilometer Reichweite – und einen Preis von rund 92.000 Euro.

1 KByte DNA-Speicher für 1.000 Euro

ACACTCTCACTGACAGACTGACACACTGACACACTGACACACTCACACAGACAGAGAGTGAGAGAGTGACTCAGTCTGTG – so lesen sich die „1.000 Euro“ dieser Überschrift auf der DNA-Card eines französischen Unternehmens. Biomemory stellte den ersten frei verfügbaren und von jedem kaufbaren Textspeicher vor, der auf der menschlichen DNA basiert. Datenspeichern ist einfach, doch um die Daten abzurufen, muss die DNA-Card an ein Labor mit einem DNA-Sequenzer (Eurofins Genomics) geschickt werden, was im Preis inbegriffen ist. Sobald fünf Bestellungen à zehn Karten vorliegen, werden diese produziert. Die Firma sieht die Card eher als Machbarkeitsstudie und plant, zeitnah einen Serverspeicher mit DNA-Speichertechnologie vorzustellen.

Militär schützt Synagogen

Ab 6. Dezember werden jüdische und israelische Einrichtungen in Kopenhagen von der dänischen Armee geschützt. Grund ist der „absolut inakzeptable Anstieg des Antisemitismus und der Unsicherheit für Juden in Dänemark“, sagte Justizminister Peter Hummelgaard. Die „terroristische Bedrohung, die über Dänemark schwebt“, sei ernst. Das Verteidigungsministerium erklärte, die Polizei habe durch die Proteste wegen Israel und der Hamas sowie gleichzeitig stattfindenden Koranverbrennungen durch einwanderungsfeindliche Gruppen sehr viel zu tun. Daher „werden die Streitkräfte die Überwachung jüdischer und israelischer Stätten in Kopenhagen unterstützen“. Das betrifft beispielsweise Synagogen und die israelische Botschaft.

Wären heute EU-Wahlen …

Würden heute EU-Wahlen stattfinden, dann müssten die Grünen 22 und die Liberalen 19 Sitze abgeben. Konservative (EVP) gewinnen 21 Sitze hinzu. Parteien der „Identität und Demokratie“ (ID) hätten 14 Sitze mehr. Derzeit hat das EU-Parlament 705 Sitze. Das ergab eine Umfrage von Europe Elects vom November 2023. Besonders im Visier ist die ID, in der sich EU-skeptische, migrationsskeptische und nationalistische Parteien zusammengetan haben – unter anderem die AfD, die Rassemblement National (Marine Le Pen) und die Lega (Matteo Salvini). Ebenso die FPÖ (Österreich), die Schwedendemokraten und die Partei für die Freiheit (Geert Wilders).

  • EVP (Konservative) Prognose: 175 (-7)
  • S&D (Sozialdemokraten) 142 (-12)
  • Renew (Liberale) 89 (-19)
  • ID 87 (+14)
  • EKR (Europäische Konservative und Reformer) 83 (+21)
  • Grüne 52 (-22)
  • Fraktionslose 51 (-6)
  • Linke 37 (-4)
  • Nicht zugeordnete Parteien 4 (+4)

Rumänien verbietet Insekten in rumänischen Produkten

Rumänien hat ein Verbot der Verwendung von neu zugelassenen EU-Lebensmitteln aus Insekten bei der Herstellung traditioneller rumänischer Produkte beschlossen. Enthalten Lebensmittel zugelassene Insektenarten, dann müssen diese getrennt von Ausstellern mit normalen Lebensmitteln und in einem besonders ausgewiesenen Bereich angeboten werden. Beschlossen wurde das Gesetz am 29. November in der Abgeordnetenkammer der Regierung. Erlaubt ist in der EU seit 2021 der Verkauf von Produkten, die mit Heimchenschrecken, Wanderheuschrecken, Larven des Gelben Mehlwurms und des Kleinen Mehlwurms produziert werden.

Tier des Jahres: Igel

Der Braunbrustigel wurde von den Spendern der Deutschen Wildtierstiftung zum Tier des Jahres 2024 ernannt. Neben dem Stacheltier hätten Eichhörnchen und Rotfuchs zur Wahl gestanden, teilte die Stiftung mit. „Damit hat ein Wildtier die Wahl zum Tier des Jahres gewonnen, das wohl jedes Kind kennt – das es aber in unserer Kulturlandschaft immer schwerer hat“, erklärte Vorstand Klaus Hackländer. Schätzungen gingen davon aus, dass inzwischen neunmal so viele Igel in Städten lebten wie auf dem Land. Es sei nicht bekannt, wie viele Igel es in Deutschland gibt.

Exporte erneut zurückgegangen

Verglichen mit September sanken Deutschlands Exporte um 0,2 Prozent auf 126,4 Milliarden Euro, wie das Statistische Bundesamt in Wiesbaden mitteilte. Im Jahresvergleich ergab sich ein Minus von 8,1 Prozent. Auch die Importe gingen zurück: um 1,2 Prozent auf 108,6 Milliarden Euro. Im Vergleich zum Oktober 2022 brachen die Einfuhren um 16,3 Prozent ein.

Englisch als 2. Amtssprache?

Daniel Terzenbach, Vorstandsmitglied der Bundesagentur für Arbeit plädiert für Englisch als zweite Amts-und Geschäftssprache in Deutschland. Der Arbeitsmarkt werde immer „bunter und internationaler.“ Er sagt: „Irgendwann müssen wir anerkennen, dass es kein kultureller Suizid ist, wenn wir, langfristig gesehen, auf dem Arbeitsmarkt neben Deutsch auch Englisch sprechen.“ Er ist seit Kurzem zuständig für die Arbeitsmarktintegration von Flüchtlingen.

Kotkugelroller gekürt

Der Stierkäfer (Typhaeus typhoeus) wurde zum Insekt des Jahres 2024 gewählt und gehört mit 14 bis 20 Millimetern zu den größeren Käferarten Deutschlands. Er nutzt den Dung von Pflanzenfressern wie Kaninchen, Rehe, Rinder oder Pferde zur Versorgung seiner Larven und spielt damit eine zentrale Rolle in unserem Ökosystem. Neben dem Verlust von Lebensraum leidet der Käfer auch unter dem Einsatz von Entwurmungsmitteln in der Weidetierhaltung, da diese nicht nur giftig für die Würmer – sondern als Kot ausgeschieden – auch eine Gefahr für Insekten sind. Mit der Wahl sollen Insekten mit besonderer Wichtigkeit für Ökosysteme oder wegen ihrer Seltenheit mehr Aufmerksamkeit erhalten.

Mehr CO₂ als Belgien in einem Jahr

Russland hat mit dem Ukraine-Krieg in den ersten anderthalb Jahren mehr klimaschädliche Treibhausgase verursacht als ein Land wie Belgien in einem Jahr. Für jene Zeitspanne errechnete ein Forscherteam rund um den Niederländer Lennard de Klerk 150 Millionen Tonnen an CO₂-Äquivalenten. Von CO₂-Äquivalenten ist die Rede, wenn andere Treibhausgase – wie Methan – in CO₂-Emissionen umgerechnet werden. Laut der Studie entstanden rund ein Viertel durch die eigentliche Kriegsführung (Treibstoffverbrauch der Truppen, militärische Ausrüstung und Geschosse), 15 Prozent durch Brände und zwölf Prozent durch Umwege im Rahmen der Sperrung der Lufträume für viele Airlines. Für den Wiederaufbau veranschlagt das Forscherteam 36 Prozent (54,7 Millionen CO₂-Äquivalente). Die Forscher erfanden einen „durchschnittlichen CO₂-Schattenpreis von 64 US-Dollar pro Tonne CO₂-Äquivalent“ und bezifferten daraufhin für Russland in der Ukraine 9,6 Milliarden US-Dollar Klimaschäden. Wie viel die Ukraine verursachte, wurde nicht bekannt.

Wohnungsbesitz in Deutschland rückläufig

Deutschland ist – was Wohnungen und Häuser betrifft – das einzige EU-Land mit mehr Mietern als Eigentümern. Der Anteil von Eigentümern nahm hier um zwei Prozentpunkte auf 47 Prozent ab. In Österreich, dem Land mit der zweitniedrigsten Eigentümerquote, ging der Anteil von 54 auf 51 Prozent zurück. Auf EU-Ebene beträgt der Anteil der Eigentümer 69 Prozent, während 31 Prozent Mieter sind. Im Durchschnitt ist die Eigentümerquote um knapp einen Prozentpunkt gesunken. In den östlichen EU-Ländern wie Rumänien (95 Prozent), der Slowakei (93 Prozent), Kroatien (91 Prozent) und Ungarn (90 Prozent) ist die Eigentümerquote signifikant höher. Dänemark hat eine Eigentümerquote von 60 Prozent, Frankreich von 63 Prozent. In Europa weist lediglich die Schweiz mit 42 Prozent einen noch niedrigeren Eigentümeranteil auf als Deutschland.

 

 

 



Epoch TV
Epoch Vital
Kommentare
Liebe Leser,

vielen Dank, dass Sie unseren Kommentar-Bereich nutzen.

Bitte verzichten Sie auf Unterstellungen, Schimpfworte, aggressive Formulierungen und Werbe-Links. Solche Kommentare werden wir nicht veröffentlichen. Dies umfasst ebenso abschweifende Kommentare, die keinen konkreten Bezug zum jeweiligen Artikel haben. Viele Kommentare waren bisher schon anregend und auf die Themen bezogen. Wir bitten Sie um eine Qualität, die den Artikeln entspricht, so haben wir alle etwas davon.

Da wir die Verantwortung für jeden veröffentlichten Kommentar tragen, geben wir Kommentare erst nach einer Prüfung frei. Je nach Aufkommen kann es deswegen zu zeitlichen Verzögerungen kommen.


Ihre Epoch Times - Redaktion